Flpo antibody
Webflp recombinase Alt name EFS promoter driving FlpO recombinase Insert Size (bp) 212 Entrez Gene flp Promoter EF1a/EFS promoter inserted Cloning Information Cloning method Restriction Enzyme 5′ cloning site SnaI (destroyed during cloning) 3′ cloning site XbaI (not destroyed) 5′ sequencing primer ccagtacatgaccttatggg WebLearn more about Addgene materials from user-contributed reports describing AAV and antibody experiments. Sequence Analyzer. Basic analysis for a user-entered sequence; includes restriction sites and map. ... -FlpO-bGHpA: hSyn: none: rg* Zeng: 55634: pAAV-EF1a-mCherry-IRES-Flpo: EF1a: mCherry (not a fusion tag) 1, rg* Deisseroth: 55637: …
Flpo antibody
Did you know?
WebGrowth in Bacteria Bacterial Resistance (s) Ampicillin, 100 μg/mL Growth Temperature 37°C Growth Strain (s) DH5alpha Copy number High Copy Gene/Insert Gene/Insert name FlpO-2A-Cre Species S. cerevisiae … WebFLPo is a mouse codon-optimized FLP. How to cite this plasmid ( Back to top ) These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were …
WebNov 21, 2016 · The dual expression vector was used for the fluorescence lifetime imaging (FLIM) screen, the ratiometric screen (RFP brightness and green component), the photostability assay using widefield... WebMar 19, 2024 · The Flp recombinases (Flp, Flpe, and Flpo) bind and cleave DNA Frt sites. We created a transgenic mouse strain ( [Fsp1-Flpo]) expressing the Flpo recombinase in fibroblasts. This strain was...
WebJul 21, 2016 · For the stop codon knock-in mouse line (hereon known as DBH-p2a-FLPo) targeting vector, the 5’ homology arm is a 1kb fragment going from -1000 to 0 relative to the stop codon of the gene and the 3’ homology arm is a 1kb fragment extending +4 to +1003 (deleting the PAM motif of the sgRNA). WebGFP; green fluorescent protein; Gene ID 7011691 UniProt ID B6UPG7 Product Notes This is a product of Creative Biolabs' Hi-Affi™ recombinant antibody portfolio, which has several benefits including: • Increased sensitivity • Confirmed specificity • High repeatability • Excellent batch-to-batch consistency • Sustainable supply
WebThis antibody reacts with a membrane-bound isoenzyme of placental alkaline phosphatase (PLAP) occurring in the placenta during the 3rd trimester of gestation. It is useful in the identification of testicular germ cell tumors. Unlike germ cell tumors, PLAP-positive somatic cell tumors uniformly express epithelial membrane antigen (EMA).
WebFlp polyclonal antibody Cat. No. C15310169 Type: Polyclonal Specificity: Size: 100 µl Isotype: NA Concentration: not determined Host: Rabbit Lot No.: A280-004 Purity: Whole … flood insurance obligationsWebBackbone manufacturer Allen Institute Vector type AAV Growth in Bacteria Bacterial Resistance (s) Ampicillin, 100 μg/mL Growth Temperature 37°C Growth Strain (s) NEB Stable Copy number High Copy Gene/Insert Gene/Insert name FlpO Species Synthetic Insert Size (bp) 1296 Promoter Beta Globin minimal promoter Cloning Information flood insurance outbuilding exemptionWebSep 12, 2024 · In order to express the Flp recombinase in mammary gland epithelial cells, we placed the mouse codon-optimized Flp ( Flpo) under the control of the MMTV promoter. Transgenic mice were generated by pronuclear microinjection. 17 founder animals were obtained, of which ten showed germline transmission. great men of the bible who sinnedWebRFP Antibody (MA5-15257) in WB 1:1000 (1 µg/mL) Ab dilution probed against HEK293 cells transfected with RFP-tagged protein vector; untransfected control (1), transfected … great men of the bible studyWebFlp recombinase is used as a tool for the generation of transgenic animals. Limitations This product is for research use only and is not approved for use in humans or in clinical … flood insurance oak island ncWebListed below are anti-Flp antibodies from multiple suppliers. Flp is a reported alias name for the human gene HPD, or '4-hydroxyphenylpyruvate dioxygenase'. The 393 … flood insurance point of saleWebFlp-mediated excision of the transcriptional “Stop” leading to TGFβCA expression is represented. Primers used for DNA genotyping (panel c), RT-PCR (panel d, e and Fig. 5b–d) are represented by grey... We would like to show you a description here but the site won’t allow us. flood insurance not in flood zone